A. You have generated a number of Lac negative mutants using transposon Tn5 muta

A.
You have generated a number of Lac negative mutants using transposon Tn5
mutagenesis. To map the sites of insertion of the Tn5 in the lac operon you
carry out colony PCR using combinations of Lac1/Tn5 and Tn5/Lac2 primers.
Attached you will find the results of a BLAST search using as query search the
Tn5 junction sequence derived from one of these mutants.By reference to this alignment (i)
Write out the Tn5 target site sequence
for this particular insertion(ii)Identify whether the template used was
derived from a Lac1/Tn5 primer amplification or a Tn5/Lac2 primer
amplification?(iii)
Describe why this particular insertion gave rise to a Lac negative phenotype(iv)
Identify the first nine bases you would expect to find for the raw sequence
data derived from the PCR product from the other side of the Tn5 insertion.Sequence alignment for part A of the question. gb|J01636|ECOLAC E.coli
lactose operon with lacI (79-1161) lacZ (1284-4358) lacY (4410-5663) and lacA
genes.
Length = 7477Score =773 bits (390) Expect = 0.0Identities =
390/390 (100%)Strand = Plus /
PlusQuery: 1
ttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcac 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 1261
ttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcac 1320Query: 61
acaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtga 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 1321
acaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtga 1380Query: 121
ctgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccag 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 1381 ctgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccag
1440Query: 181
ctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaa 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 1441
ctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaa 1500Query: 241
tggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctgga 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 1501
tggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctgga 1560
Attachments: